You can deploy this model and start earning money today!

zhangtaolab/
plant-dnagpt-6mer-H3K27ac

Name: plant-dnagpt-6mer-H3K27ac
Availability: InStock

Views

No views yet

Plant foundation DNA large language models

The plant DNA large language models (LLMs) contain a series of foundation models based on different model architectures, which are pre-trained on various plant reference genomes.
All the models have a comparable model size between 90 MB and 150 MB, BPE tokenizer is used for tokenization and 8000 tokens are included in the vocabulary.

Developed by: zhangtaolab

Model Sources

Repository: Plant DNA LLMs
Manuscript: Versatile applications of foundation DNA language models in plant genomes

Architecture

The model is trained based on the OpenAI GPT-2 model with modified tokenizer specific for DNA sequence.

This model is fine-tuned for predicting H3K4me3 histone modification.

How to use

Install the runtime library first:

pip install transformers

Here is a simple code for inference:

python

from transformers import AutoModelForSequenceClassification, AutoTokenizer, pipeline
model_name = 'plant-dnagpt-6mer-H3K4me3'
# load model and tokenizer
model = AutoModelForSequenceClassification.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
tokenizer = AutoTokenizer.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
# inference
sequences = ['TTCATCTCGTCCGACGCTTCAACCCGCACCGATCCTGCGCCACCCCTTCGCCGGCGGCTTCTCCCCTCCTCTTCCTCCGCCGCTGCATCGCCGTCCCAGGAACTTGGACACGTCGCCTCTCGCCGGCGACCATGTACCGCGCCCTCCGCTCTCTCAAGGTTTCCCCGTCTGCACCCCCCCAACCTTCTACGACGTGTGGCGTTGCGTGTCTCGATCCATTTGGGATGAATGCGCTGGAGTGTTAGA',
             'ATCAATATTCCCAACAGGTTTTGAAGCAATGGATGAAACATCATCCTTCACGGAACTGGATTATGGGATTCGCCGGCTGGACCACGCTGTTGGGAATGTGCCGGAGCTGGGTCCTGTAGTGGATTACATCAAGGCGTTTACGGGGTTTCATGAATTTGCGGAGTTTACAGCT']
pipe = pipeline('text-classification', model=model, tokenizer=tokenizer,
                trust_remote_code=True, top_k=None)
results = pipe(sequences)
print(results)

Training data

We use GPT2ForSequenceClassification to fine-tune the model.
Detailed training procedure can be found in our manuscript.

Hardware

Model was trained on a NVIDIA GTX1080Ti GPU (11 GB).

zhangtaolab/plant-dnagpt-6mer-H3K27ac