Views
No views yet
1from prokbert.prokbert_tokenizer import ProkBERTTokenizer
2from transformers import MegatronBertForSequenceClassification
3finetuned_model = "neuralbioinfo/prokbert-mini-c-phage"
4kmer = 1
5shift= 1
6
7tok_params = {'kmer' : kmer,
8 'shift' : shift}
9tokenizer = ProkBERTTokenizer(tokenization_params=tok_params)
10model = MegatronBertForSequenceClassification.from_pretrained(finetuned_model)
11sequence = 'CACCGCATGGAGATCGGCACCTACTTCGACAAGCTGGAGGCGCTGCTGAAGGAGTGGTACGAGGCGCGCGGGGGTGAGGCATGACGGACTGGCAAGAGGAGCAGCGTCAGCGC'
12inputs = tokenizer(sequence, return_tensors="pt")
13# Ensure that inputs have a batch dimension
14inputs = {key: value.unsqueeze(0) for key, value in inputs.items()}
15# Generate outputs from the model
16outputs = model(**inputs)
17print(outputs)| Parameter | Description |
|---|---|
| Model Size | 24.9 million parameters |
| Max. Context Size | 1022 bp |
| Training Data | 206.65 billion nucleotides |
| Layers | 6 |
| Attention Heads | 6 |
1try:
2 import prokbert
3 print("ProkBERT is already installed.")
4except ImportError:
5 !pip install prokbert
6 print("Installed ProkBERT.")| method | L | auc_class1 | acc | f1 | mcc | recall | sensitivity | specificity | tn | fp | fn | tp | Np | Nn | eval_time |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| DeepVirFinder | 256 | 0.734914 | 0.627163 | 0.481213 | 0.309049 | 0.345317 | 0.345317 | 0.909856 | 4542 | 450 | 3278 | 1729 | 5007 | 4992 | 7580 |
| DeepVirFinder | 512 | 0.791423 | 0.708 | 0.637717 | 0.443065 | 0.521192 | 0.521192 | 0.889722 | 4510 | 559 | 2361 | 2570 | 4931 | 5069 | 2637 |
| DeepVirFinder | 1024 | 0.826255 | 0.7424 | 0.702678 | 0.505333 | 0.605651 | 0.605651 | 0.880579 | 4380 | 594 | 1982 | 3044 | 5026 | 4974 | 1294 |
| DeepVirFinder | 2048 | 0.853098 | 0.7717 | 0.743339 | 0.557177 | 0.6612 | 0.6612 | 0.8822 | 4411 | 589 | 1694 | 3306 | 5000 | 5000 | 1351 |
| INHERIT | 256 | 0.75982 | 0.6943 | 0.67012 | 0.393179 | 0.620008 | 0.620008 | 0.76883 | 3838 | 1154 | 1903 | 3105 | 5008 | 4992 | 2131 |
| INHERIT | 512 | 0.816326 | 0.7228 | 0.651408 | 0.479323 | 0.525248 | 0.525248 | 0.914973 | 4638 | 431 | 2341 | 2590 | 4931 | 5069 | 2920 |
| INHERIT | 1024 | 0.846547 | 0.7264 | 0.659447 | 0.495935 | 0.527059 | 0.527059 | 0.927825 | 4615 | 359 | 2377 | 2649 | 5026 | 4974 | 3055 |
| INHERIT | 2048 | 0.864122 | 0.7365 | 0.668595 | 0.518541 | 0.5316 | 0.5316 | 0.9414 | 4707 | 293 | 2342 | 2658 | 5000 | 5000 | 3225 |
| MINI | 256 | 0.846745 | 0.7755 | 0.766462 | 0.552855 | 0.735623 | 0.735623 | 0.815505 | 4071 | 921 | 1324 | 3684 | 5008 | 4992 | 6.68888 |
| MINI | 512 | 0.924973 | 0.8657 | 0.859121 | 0.732696 | 0.83046 | 0.83046 | 0.89998 | 4562 | 507 | 836 | 4095 | 4931 | 5069 | 16.3681 |
| MINI | 1024 | 0.956432 | 0.9138 | 0.911189 | 0.829645 | 0.879825 | 0.879825 | 0.94813 | 4716 | 258 | 604 | 4422 | 5026 | 4974 | 51.3319 |
| MINI-C | 256 | 0.827635 | 0.7512 | 0.7207 | 0.51538 | 0.640974 | 0.640974 | 0.861779 | 4302 | 690 | 1798 | 3210 | 5008 | 4992 | 7.33697 |
| MINI-C | 512 | 0.913378 | 0.8466 | 0.834876 | 0.69725 | 0.786453 | 0.786453 | 0.905109 | 4588 | 481 | 1053 | 3878 | 4931 | 5069 | 17.6749 |
| MINI-C | 1024 | 0.94644 | 0.8937 | 0.891564 | 0.788427 | 0.869479 | 0.869479 | 0.918175 | 4567 | 407 | 656 | 4370 | 5026 | 4974 | 54.204 |
| MINI-LONG | 256 | 0.777697 | 0.71495 | 0.686224 | 0.437727 | 0.622404 | 0.622404 | 0.807792 | 8065 | 1919 | 3782 | 6234 | 10016 | 9984 | 6.10304 |
| MINI-LONG | 512 | 0.880831 | 0.81405 | 0.798001 | 0.632855 | 0.744879 | 0.744879 | 0.881338 | 8935 | 1203 | 2516 | 7346 | 9862 | 10138 | 12.1307 |
| MINI-LONG | 1024 | 0.9413 | 0.88925 | 0.884917 | 0.781465 | 0.847195 | 0.847195 | 0.931745 | 9269 | 679 | 1536 | 8516 | 10052 | 9948 | 30.5088 |
| MINI-LONG | 2048 | 0.964551 | 0.929 | 0.927455 | 0.85878 | 0.9077 | 0.9077 | 0.9503 | 9503 | 497 | 923 | 9077 | 10000 | 10000 | 94.404 |
| Virsorter2 | 512 | 0.620782 | 0.6259 | 0.394954 | 0.364831 | 0.247617 | 0.247617 | 0.993884 | 5038 | 31 | 3710 | 1221 | 4931 | 5069 | 2057 |
| Virsorter2 | 1024 | 0.719898 | 0.7178 | 0.621919 | 0.51036 | 0.461799 | 0.461799 | 0.976478 | 4857 | 117 | 2705 | 2321 | 5026 | 4974 | 3258 |
| Virsorter2 | 2048 | 0.816142 | 0.8103 | 0.778724 | 0.647532 | 0.6676 | 0.6676 | 0.953 | 4765 | 235 | 1662 | 3338 | 5000 | 5000 | 5737 |
@ARTICLE{10.3389/fmicb.2023.1331233,
AUTHOR={Ligeti, Balázs and Szepesi-Nagy, István and Bodnár, Babett and Ligeti-Nagy, Noémi and Juhász, János},
TITLE={ProkBERT family: genomic language models for microbiome applications},
JOURNAL={Frontiers in Microbiology},
VOLUME={14},
YEAR={2024},
URL={https://www.frontiersin.org/articles/10.3389/fmicb.2023.1331233},
DOI={10.3389/fmicb.2023.1331233},
ISSN={1664-302X},
ABSTRACT={...}
}